ad gfp u6 scrmb shrna Search Results


95
Vector Biolabs scrambled shrna
Scrambled Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV9-GFP/pmc08011979-199-19-32
Average 95 stars, based on 1 article reviews
scrambled shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Vector Biolabs control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa
Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV5-GFP/10__1523_slash_jneurosci__0406___21__2021-79-11-17
Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
ViraQuest Inc ad-cmv-gfp/ntlacz
Ad Cmv Gfp/Ntlacz, supplied by ViraQuest Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/vqad+cmv+egfp/pm35023731__ac1c02439_si_001-11-57-12
Average 90 stars, based on 1 article reviews
ad-cmv-gfp/ntlacz - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Vector Biolabs aav8 mcherry u6 scrmb shrna
(A) Lentiviral vectors for <t>U6-driven</t> expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter <t>(mCherry</t> or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .
Aav8 Mcherry U6 Scrmb Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV8-mCherry/pmc09835819-253-7-9
Average 95 stars, based on 1 article reviews
aav8 mcherry u6 scrmb shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Vector Biolabs gfp u6 scrmb shrna
(A) Lentiviral vectors for <t>U6-driven</t> expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter <t>(mCherry</t> or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .
Gfp U6 Scrmb Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV2-GFP-U6-shRNA/pmc08804582-43-14-21
Average 95 stars, based on 1 article reviews
gfp u6 scrmb shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Vector Biolabs aav1 mcherry u6 scrmb shrna 5 ccgg caacaagatgaagagcaccaactcgagtt ggtgctcttcatcttgttg ttttt 3
(A) Lentiviral vectors for <t>U6-driven</t> expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter <t>(mCherry</t> or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .
Aav1 Mcherry U6 Scrmb Shrna 5 Ccgg Caacaagatgaagagcaccaactcgagtt Ggtgctcttcatcttgttg Ttttt 3, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV1-mCherry/pmc07580783-13-0-4
Average 95 stars, based on 1 article reviews
aav1 mcherry u6 scrmb shrna 5 ccgg caacaagatgaagagcaccaactcgagtt ggtgctcttcatcttgttg ttttt 3 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Vector Biolabs aav9 u6 scrmb shrna
(A) Lentiviral vectors for <t>U6-driven</t> expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter <t>(mCherry</t> or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .
Aav9 U6 Scrmb Shrna, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV9-GFP-U6-shRNA/pm35084807-58-32-38
Average 95 stars, based on 1 article reviews
aav9 u6 scrmb shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
Vector Biolabs shaav 279053 aav8 gfp u6 scrmb shrna vector biolabs
(A) Lentiviral vectors for <t>U6-driven</t> expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter <t>(mCherry</t> or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .
Shaav 279053 Aav8 Gfp U6 Scrmb Shrna Vector Biolabs, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ad+gfp+u6+scrmb+shrna/AAV-m-NOS1-shRNA/pmc06728189-864-99-101
Average 95 stars, based on 1 article reviews
shaav 279053 aav8 gfp u6 scrmb shrna vector biolabs - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


(A) Lentiviral vectors for U6-driven expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter (mCherry or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .

Journal: Cell genomics

Article Title: Genome-scale CRISPR screening in a single mouse liver

doi: 10.1016/j.xgen.2022.100217

Figure Lengend Snippet: (A) Lentiviral vectors for U6-driven expression of an sgRNA and hepatocyte-specific expression of a fluorescent reporter (mCherry or mTurq2). (B) Images of endogenous mCherry and mTurq2 fluorescence in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Livers were counterstained with phalloidin (green) to label actin. Scale bars, 100 μm. (C) Percentage of mCherry-, mTurq2-, and double-positive hepatocytes in livers from mice 4 days after injection with an equal mixture of sgAAVS1-mCherry and sgAAVS1-mTurq2 lentiviruses. Error bars indicate standard deviation. n = 3 mice per dose and 200 hepatocytes per mouse. See also .

Article Snippet: To deliver AAV-shRNA, a stock solution of AAV8-mCherry-U6-scrmb-shRNA (AAV-shScramble, Vector Biolabs) and/or AAV8-GFP-U6-mNDST1-shRNA (AAV-shNDST1, Vector Biolabs) was diluted in PBS to a total volume of 20 μL and injected intraperitoneally into postnatal day five mice.

Techniques: Expressing, Fluorescence, Injection, Standard Deviation

(A) KEGG gene sets exhibiting significant depletion (FDR q < 0.05) at the endpoint of the screen ranked by FDR q-value (−log10). Bars extending to the end of the plot indicate an FDR q-value of 0. (B) KEGG gene sets exhibiting significant depletion (FDR q < 0.05) in our screen relative to screens in either mouse ESCs (dark gray bars) or human hepatocellular carcinoma (HCC) cell lines (light gray bars) ranked by FDR q-value (−log10) for our screen relative to mouse ESCs. Bars extending to the end of the plot indicate an FDR q-value of 0. (C) Median fold change (log2)for genes in the KEGG gene set for antigen processing and presentation in quantile-normalized ESC screens, HCC cell line screens, and our screen. Genes uniquely depleted in our screen are highlighted in red. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (D) Median fold change (log2) for genes in the KEGG gene set for glycosaminoglycan biosynthesis and heparan sulfate in quantile-normalized ESC screens, HCC cell line screens, and our screen. Genes uniquely depleted in our screen are highlighted in red. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (E) Median fold change (log2) for genes in the heparan sulfate interactome in our screen. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (F) Scheme for determining effects of NDST1 knockdown on hepatocyte proliferation (top panel). Image of liver from postnatal day 15 mouse injected with 1 × 10 10 genome copies (GC) of AAV-shNDST1 and AAV-shScramble on postnatal day 5 immunostained for Ki67 (white), GFP (green), and mCherry (magenta) and counterstained for Hoechst (blue) (left panel). Scale bar, 25 μm. Quantification of proliferation as inferred by Ki67 positivity in shNDST1 hepatocytes relative to shScramble hepatocytes (right panel). Bar and whiskers indicate mean and standard deviation across mice, respectively, and closed and open circles represent values from male and female mice, respectively. n = 2 male and 2 female mice and 200 cells per shRNA per mouse. **p = 0.0023 by two-tailed Fisher’s exact test. See also .

Journal: Cell genomics

Article Title: Genome-scale CRISPR screening in a single mouse liver

doi: 10.1016/j.xgen.2022.100217

Figure Lengend Snippet: (A) KEGG gene sets exhibiting significant depletion (FDR q < 0.05) at the endpoint of the screen ranked by FDR q-value (−log10). Bars extending to the end of the plot indicate an FDR q-value of 0. (B) KEGG gene sets exhibiting significant depletion (FDR q < 0.05) in our screen relative to screens in either mouse ESCs (dark gray bars) or human hepatocellular carcinoma (HCC) cell lines (light gray bars) ranked by FDR q-value (−log10) for our screen relative to mouse ESCs. Bars extending to the end of the plot indicate an FDR q-value of 0. (C) Median fold change (log2)for genes in the KEGG gene set for antigen processing and presentation in quantile-normalized ESC screens, HCC cell line screens, and our screen. Genes uniquely depleted in our screen are highlighted in red. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (D) Median fold change (log2) for genes in the KEGG gene set for glycosaminoglycan biosynthesis and heparan sulfate in quantile-normalized ESC screens, HCC cell line screens, and our screen. Genes uniquely depleted in our screen are highlighted in red. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (E) Median fold change (log2) for genes in the heparan sulfate interactome in our screen. The bounds of the box indicate the first and third quartiles, and the whiskers extend to the furthest data point that is within 1.5 times the interquartile range. (F) Scheme for determining effects of NDST1 knockdown on hepatocyte proliferation (top panel). Image of liver from postnatal day 15 mouse injected with 1 × 10 10 genome copies (GC) of AAV-shNDST1 and AAV-shScramble on postnatal day 5 immunostained for Ki67 (white), GFP (green), and mCherry (magenta) and counterstained for Hoechst (blue) (left panel). Scale bar, 25 μm. Quantification of proliferation as inferred by Ki67 positivity in shNDST1 hepatocytes relative to shScramble hepatocytes (right panel). Bar and whiskers indicate mean and standard deviation across mice, respectively, and closed and open circles represent values from male and female mice, respectively. n = 2 male and 2 female mice and 200 cells per shRNA per mouse. **p = 0.0023 by two-tailed Fisher’s exact test. See also .

Article Snippet: To deliver AAV-shRNA, a stock solution of AAV8-mCherry-U6-scrmb-shRNA (AAV-shScramble, Vector Biolabs) and/or AAV8-GFP-U6-mNDST1-shRNA (AAV-shNDST1, Vector Biolabs) was diluted in PBS to a total volume of 20 μL and injected intraperitoneally into postnatal day five mice.

Techniques: Injection, Standard Deviation, shRNA, Two Tailed Test

KEY RESOURCES TABLE

Journal: Cell genomics

Article Title: Genome-scale CRISPR screening in a single mouse liver

doi: 10.1016/j.xgen.2022.100217

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: To deliver AAV-shRNA, a stock solution of AAV8-mCherry-U6-scrmb-shRNA (AAV-shScramble, Vector Biolabs) and/or AAV8-GFP-U6-mNDST1-shRNA (AAV-shNDST1, Vector Biolabs) was diluted in PBS to a total volume of 20 μL and injected intraperitoneally into postnatal day five mice.

Techniques: Plasmid Preparation, RNA Sequencing Assay, CRISPR, Sequencing, Clone Assay, Amplification, Recombinant, Knock-Out, Software